View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0639_low_12 (Length: 241)
Name: NF0639_low_12
Description: NF0639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0639_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 3 - 73
Target Start/End: Original strand, 50746282 - 50746352
Alignment:
Q |
3 |
gaaccataagaaggaaagcgtttcaatattctccacgtcagattgagttacaggtggtgtgtttgtctgac |
73 |
Q |
|
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50746282 |
gaacgataagaaggaaaacgtttcaatattctccacgtcagattgagttacaggtggtgtgtttgtctgac |
50746352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University