View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0639_low_8 (Length: 260)
Name: NF0639_low_8
Description: NF0639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0639_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 30 - 247
Target Start/End: Complemental strand, 44390824 - 44390597
Alignment:
| Q |
30 |
tgttgagttggtaccgtgactagctgccaaaatagtggcattagctgaaacacaatcctctattaggggacaggtgcgatcaaggacctgaacacaagat |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44390824 |
tgttgagttggtaccatgactagctgccaaaatagtggcattagctgaaacacaatcctctattaggtgacaggtgtgatcaaggacctgaacacaagat |
44390725 |
T |
|
| Q |
130 |
tatgagacatcttgccagagcttgaggtttctatttcaatatgctccatagcacaacaacaaaat----------ctcttgtaataactgatgtaacaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
44390724 |
tatgagacatcttgccagagcttgaggtttctagttcaatatgctccatagcacaacaacaaaatgttgagaaagctcttgtaatagctgatgtaacaat |
44390625 |
T |
|
| Q |
220 |
tcgaaaaatagtgtcaaccattgagttc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44390624 |
tcgaaaaatagtgtcaaccattgagttc |
44390597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University