View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0640_high_2 (Length: 348)
Name: NF0640_high_2
Description: NF0640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0640_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 175 - 338
Target Start/End: Original strand, 25785267 - 25785430
Alignment:
| Q |
175 |
tgtagttttctgcaacgttgttgtgcgaatgaaattgcaaattatgcactatgtgattcggttttagttaggaatattaaatgggttattatttgagctc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25785267 |
tgtagttttctgcaacgttgttgtgcgaatgaaattgcaaattatgcactatgtgattcggttttagttaggaatattaaatgggttattatttgagctc |
25785366 |
T |
 |
| Q |
275 |
agagaggtataacattattattctttctgatggtatccactggcaatgtgtttgttaatctctg |
338 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||| ||||||||| |||||| |||||||||||||| |
|
|
| T |
25785367 |
agagagttataacattattattttttcttatgttatccactgacaatgtttttgttaatctctg |
25785430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 28 - 112
Target Start/End: Original strand, 25785120 - 25785204
Alignment:
| Q |
28 |
agcaagaaccaaaaggcgcggcaacctcgccaccgcaccgttcctttctgttctcaacataccaacatggttagtcttacactcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25785120 |
agcaagaaccaaaaggcgcggcaacctcgccaccgcgccgttcctttctgttctcaacataccaacatggttagtcttacactcc |
25785204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University