View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0640_high_7 (Length: 226)
Name: NF0640_high_7
Description: NF0640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0640_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 67 - 135
Target Start/End: Complemental strand, 11496056 - 11495988
Alignment:
| Q |
67 |
agttacatttgttcacttctattttcttaaattattatcggtgtttacaagttagtgttgtgtttgatg |
135 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11496056 |
agttacatttgctcacttctattttcttaaattattaccggtgtttacaagttagtgttgtgtttgatg |
11495988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 125
Target Start/End: Complemental strand, 10338641 - 10338595
Alignment:
| Q |
79 |
tcacttctattttcttaaattattatcggtgtttacaagttagtgtt |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| | ||||||| |
|
|
| T |
10338641 |
tcacttctattttcttaaattattatcaatgtttacacgctagtgtt |
10338595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 114
Target Start/End: Complemental strand, 29587723 - 29587677
Alignment:
| Q |
68 |
gttacatttgttcacttctattttcttaaattattatcggtgtttac |
114 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
29587723 |
gttacatttaatcacttccattttcttaaattattaccggtgtttac |
29587677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 109
Target Start/End: Complemental strand, 31652480 - 31652450
Alignment:
| Q |
79 |
tcacttctattttcttaaattattatcggtg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31652480 |
tcacttctattttcttaaattattatcggtg |
31652450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University