View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0640_low_10 (Length: 253)
Name: NF0640_low_10
Description: NF0640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0640_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 40452911 - 40452674
Alignment:
Q |
1 |
ttacatcattcactttcactttaaaatgnnnnnnnggggagcgtgagcaaaataccaagtcaacacactgcgcagctctcactcaggcagcaaggtatga |
100 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40452911 |
ttacatcattcactttcactttaaaatgaaaaaaaggggagcgtgagcaaaatacaaagtcaacacactgcgcagctctcactcaggcagcaaggtatga |
40452812 |
T |
 |
Q |
101 |
ttcattttcatttacaatcaaccaatcgcctaattatttaattatttataagtgttgttctgannnnnnnnnnnnnnnnnnncaaattaagaacatataa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
40452811 |
ttcattttcatttacaatcaaccaatcgcctaattatttaattatttataagtgttgttctga---ttttttttttctttttcaaattaagaacatataa |
40452715 |
T |
 |
Q |
201 |
ctatgtttaaaaagaaaaagatggaaatcagcagcaacagc |
241 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40452714 |
ctatgtttaaaaagaaaaagatggaaatcagcagcaacagc |
40452674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University