View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0640_low_12 (Length: 226)
Name: NF0640_low_12
Description: NF0640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0640_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 11496094 - 11496205
Alignment:
Q |
19 |
caattggaaatgtcagtgcaatagtcactctgatcttaaatataagcaaaaatttacaaatctctctctcttgttctaaaggaagaaatgagagaaaccc |
118 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11496094 |
caatttgaaatgtcagtgcaatagtcactctgatcttaaatataagcaaaaatttacaaatctctctctcttgttctaaaggaagaaatgagagaaaccc |
11496193 |
T |
 |
Q |
119 |
agaaatcaaatg |
130 |
Q |
|
|
| |||||||||| |
|
|
T |
11496194 |
ataaatcaaatg |
11496205 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 71
Target Start/End: Original strand, 33423330 - 33423358
Alignment:
Q |
43 |
tcactctgatcttaaatataagcaaaaat |
71 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
33423330 |
tcactctgatcttaaatataagcaaaaat |
33423358 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University