View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_high_27 (Length: 297)
Name: NF0641_high_27
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 36388308 - 36388564
Alignment:
| Q |
13 |
cagatgattaacaaatttatatcaaatatt-caataaaaaatggtaacaaaatctttaaaggatatgggcctaaaaagtctaactcgtcaccaatatcct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36388308 |
cagatgattaacaaatttatatcaaatatttcaataaaaaatggtaacaaaatctttaaaggatatgggcctaaaaagtctaactcgtcaccaatatcct |
36388407 |
T |
|
| Q |
112 |
caggtatattagccaaatggacaatattttcactaactggatcataaactcgttgatattggaaagtaagaatagccttcctgaacgactcttcgtaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36388408 |
caggtatattagccaaatggacaatattttcactaactggatcataaactcgttgatattggaaagtaagaatagccttcctgaacgactcttcgtaaaa |
36388507 |
T |
|
| Q |
212 |
gggaggtacagaaacaccgttgtatttcaagtgcttaagaacctgtacattacaatt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36388508 |
gggaggtacagaaacaccgttgtatttcaagtgcttaagaacctgtacattacaatt |
36388564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1221 times since January 2019
Visitors: 4114