View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_high_33 (Length: 262)
Name: NF0641_high_33
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 53096267 - 53096511
Alignment:
| Q |
1 |
ttccatttctagtcccatttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096267 |
ttccatttctcgtcccatttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttc |
53096366 |
T |
 |
| Q |
101 |
tttggcaccatgnnnnnnnggaacttctaaactccggatgagctgactaatgtgaacatgagctgcacaactcttccatgactttttatgaacaacaggt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096367 |
tttggcaccatgtttttttggaacttctaaactccggatgagctgactaatgtgaacatgagctgcacaactcttccatgactttttatgaacaacaggt |
53096466 |
T |
 |
| Q |
201 |
tcggaaatctgcattgtcattaaacatttattattggaaacaact |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53096467 |
tcggaaatctgcatcgtcattaaacatttattattggaaacaact |
53096511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 1369440 - 1369335
Alignment:
| Q |
1 |
ttccatttctagtcccatttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttc |
100 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| | | ||| ||||||| |||||| ||||||| ||||||||||||||||||||| | ||| |
|
|
| T |
1369440 |
ttccatttctcatcccattagagttttgtgctttgattagga-tatacattttgatctttggtgaactctggtttggtgacattcataacgctcagattc |
1369342 |
T |
 |
| Q |
101 |
tttggca |
107 |
Q |
| |
|
||||||| |
|
|
| T |
1369341 |
tttggca |
1369335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University