View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_high_34 (Length: 255)
Name: NF0641_high_34
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_high_34 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 30 - 255
Target Start/End: Complemental strand, 160328 - 160103
Alignment:
| Q |
30 |
tcttgatcatggattgttgattgaattgagatagacgctcatagaagaaatggaaataccnnnnnnngtgttgttgcattggttgaagttcttcatttcc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
160328 |
tcttgatcatggattgttgattgaattgagatagacgctcatagaagaaatggaaatacctttttttgtgttgttgcattggttgaagttcttcatttcc |
160229 |
T |
|
| Q |
130 |
aaggtgaattggaccaattgagattagttgaggagtgtaagcttcttgtttcacttttcggagattgtgaggaaccttgtagatgctacaatctgctaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
160228 |
aaggtgaattggaccaattgagattagttgaggagtgtaagcttcttgtttcacttttcggagattgtgaggaaccttgtagatgctacaatctgctaaa |
160129 |
T |
|
| Q |
230 |
cttaactcttctagaacttcaatgtc |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
160128 |
cttaactcttctagaacttcaatgtc |
160103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 151894 - 151668
Alignment:
| Q |
29 |
atcttgatcatggattgttgattgaattgagatagacgctcatagaagaaatggaaataccnnnnnnngtgttgttgcattggttgaagttcttcatttc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
151894 |
atcttgatcatggattgttgattgaattgagataaacgctcatagaagaaaaggaaatacctttttttgtgttcttgcattggttgaagttcttcatttc |
151795 |
T |
|
| Q |
129 |
caaggtgaattggaccaattgagattagttgaggagtgtaagcttcttgtttcacttttcggagattgtgaggaaccttgtagatgctacaatctgctaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
151794 |
caaggtgaattggaccaattgagattaattcaggagtgtaagcttcttgtttcacttttcggagattgtgaggaaccttgtagatgctacattctgctaa |
151695 |
T |
|
| Q |
229 |
acttaactcttctagaacttcaatgtc |
255 |
Q |
| |
|
|||||||| |||||| ||| ||||||| |
|
|
| T |
151694 |
acttaacttttctaggactccaatgtc |
151668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1313 times since January 2019
Visitors: 4114