View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0641_high_36 (Length: 247)

Name: NF0641_high_36
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0641_high_36
NF0641_high_36
[»] chr5 (1 HSPs)
chr5 (13-247)||(27508204-27508438)
[»] chr4 (1 HSPs)
chr4 (187-247)||(35192866-35192926)
[»] chr7 (1 HSPs)
chr7 (187-247)||(44747927-44747987)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 27508438 - 27508204
Alignment:
13 agcagagagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcgcggtggtagtaaggc 112  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
27508438 agcagggagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcacggtggtagtaaggc 27508339  T
113 gagaattgattgctgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccggttcaacatccatctctttgcggtgga 212  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||    
27508338 gagaattgattgttgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccgtttcaccatcgatctctttgcggtgga 27508239  T
213 aattccggtgacagttacacgcgtcccaaataaca 247  Q
    | ||||||||||||||||| ||| | |||||||||    
27508238 agttccggtgacagttacaagcggcgcaaataaca 27508204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 247
Target Start/End: Original strand, 35192866 - 35192926
Alignment:
187 ttcaacatccatctctttgcggtggaaattccggtgacagttacacgcgtcccaaataaca 247  Q
    |||| |||| ||||||||||||||||| ||| ||||||||||||| ||| | |||||||||    
35192866 ttcaccatcgatctctttgcggtggaagttctggtgacagttacaagcggcgcaaataaca 35192926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 247
Target Start/End: Original strand, 44747927 - 44747987
Alignment:
187 ttcaacatccatctctttgcggtggaaattccggtgacagttacacgcgtcccaaataaca 247  Q
    |||| |||| |||||||||| |||||| ||| ||||||||||||| ||| | |||||||||    
44747927 ttcaccatcgatctctttgcagtggaagttctggtgacagttacaagcggcgcaaataaca 44747987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1344 times since January 2019
Visitors: 4117