View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_high_37 (Length: 247)
Name: NF0641_high_37
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0641_high_37 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 27508438 - 27508204
Alignment:
Q |
13 |
agcagagagagccaacggtctgtgatgtgccaccggagttgcaggatgatggtggtgaaggtaaccggctgtggaaggaggagcgcggtggtagtaaggc |
112 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
27508438 |
agcagggagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcacggtggtagtaaggc |
27508339 |
T |
 |
Q |
113 |
gagaattgattgctgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccggttcaacatccatctctttgcggtgga |
212 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
T |
27508338 |
gagaattgattgttgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccgtttcaccatcgatctctttgcggtgga |
27508239 |
T |
 |
Q |
213 |
aattccggtgacagttacacgcgtcccaaataaca |
247 |
Q |
|
|
| ||||||||||||||||| ||| | ||||||||| |
|
|
T |
27508238 |
agttccggtgacagttacaagcggcgcaaataaca |
27508204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 247
Target Start/End: Original strand, 35192866 - 35192926
Alignment:
Q |
187 |
ttcaacatccatctctttgcggtggaaattccggtgacagttacacgcgtcccaaataaca |
247 |
Q |
|
|
|||| |||| ||||||||||||||||| ||| ||||||||||||| ||| | ||||||||| |
|
|
T |
35192866 |
ttcaccatcgatctctttgcggtggaagttctggtgacagttacaagcggcgcaaataaca |
35192926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 247
Target Start/End: Original strand, 44747927 - 44747987
Alignment:
Q |
187 |
ttcaacatccatctctttgcggtggaaattccggtgacagttacacgcgtcccaaataaca |
247 |
Q |
|
|
|||| |||| |||||||||| |||||| ||| ||||||||||||| ||| | ||||||||| |
|
|
T |
44747927 |
ttcaccatcgatctctttgcagtggaagttctggtgacagttacaagcggcgcaaataaca |
44747987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 879 times since January 2019
Visitors: 4101