View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_high_42 (Length: 228)
Name: NF0641_high_42
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0641_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42324758 - 42324848
Alignment:
Q |
1 |
atacctatatttggctttggtatctcatagctcactacttctttccctgtgtgttttacaatttcaatatgtcattatattctctctcatc |
91 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
42324758 |
atacctatatttggctttggtatctcatagctcactacttctttccctgtgtgtgatacaatttcaatatgtcattatattctctctcatc |
42324848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 42324876 - 42324917
Alignment:
Q |
109 |
ggcatttttcaaccattaaaatacctaccaaatgtagcatct |
150 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42324876 |
ggcatttttcaaccattaaaatacctaccaaatgtagcatct |
42324917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University