View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_high_9 (Length: 402)
Name: NF0641_high_9
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 9 - 346
Target Start/End: Original strand, 42178315 - 42178655
Alignment:
| Q |
9 |
agcataggcacattcatgagacaagcaaaacaagcatggaaaacacattcatgtcatgtgcaatttgtgtgatagagtatcatgccatatagaaccgctc |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178315 |
agcataagcacattcatgagacaagcaaaacaagcatggaaaacacactcatgtcatgtgcaatttgtgtgatagagtatcatgccatatagaaccgctc |
42178414 |
T |
|
| Q |
109 |
atgaaacaaaa-tgcaccactcaaattaacgtcatagcaagcttaggtgtaaaaa-ttgagagatattcttcaaggcaac-tataattttatttattaat |
205 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42178415 |
atgaaacaaaaatgcacctctcaaattaacgtcatagcaagcttaggtgtaaaaaattgtgagatattcttcaaggcaacatataattttatttattaat |
42178514 |
T |
|
| Q |
206 |
tcataggtttcatcaaaatagcatggaacagaatattcaataattgaaggggaataagatatgcatgcatctaccttattgtaaacttcatcccttaaac |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178515 |
tcataggtttcatcaaaatagcatggaacagaatattcaataattgaagaggaataagatatgcatgcatctaccttattgtaaacttcatcccttaaac |
42178614 |
T |
|
| Q |
306 |
aaacaagccagagaacactgcttatttcgacccacgtgcac |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178615 |
aaacaagccagagaacactgcttatttcgacccacgtgcac |
42178655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1009 times since January 2019
Visitors: 4109