View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_33 (Length: 365)
Name: NF0641_low_33
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 32 - 321
Target Start/End: Complemental strand, 20629394 - 20629110
Alignment:
| Q |
32 |
atttgttcctacttaatgtttgtcactccctcgtttcacgccttcacccactcacccattcttcatttttcagtttctcactttacactctcaacaaatc |
131 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20629394 |
atttgttcctacttaaaatttgtcactccctggtttcacgccttcacccactcacccattcttcatttttcagtttctcactttacactctcaacaaatc |
20629295 |
T |
 |
| Q |
132 |
atctcaacatttctattttcgttcttttaacatgtgcccttgattagggcacaagttaacaccatccatccaatatataaatacaaataaaccgacttac |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20629294 |
atctcaacatttctattttcgttc-tttaacatgtgcccttgattagggcacaagttaacaccatccatccaatatataaatacaaataaaccgactcac |
20629196 |
T |
 |
| Q |
232 |
tcactcactcttcatagttggagcgagcaacccttcaatccggaagacaccatggttagtttttgttttgtagaatttttctgcgtgttc |
321 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20629195 |
tcactcactgttcatagttg----gagcaacccttcaatccggaagacaccatggttagtttttgttttgtagaatttttctgagtgttc |
20629110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University