View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_34 (Length: 363)
Name: NF0641_low_34
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_34 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 4e-26; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 82 - 171
Target Start/End: Complemental strand, 3354083 - 3353994
Alignment:
| Q |
82 |
aacaaatatagtatgaatatcttgaaacttgtgtattcgaagtcttaaatgtggnnnnnnntgttttcaatataaatgtttctttaacaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3354083 |
aacaaatatagtatgaatatcttgaaacttgtgtattcgaagtcttaaatatgtaaaaaaatgttttcaatataaatgtttctttaacaa |
3353994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 3354079 - 3353994
Alignment:
| Q |
1 |
aatatagtatgaatatcttgaaacttgtgtattcgaagtcttaaatgtggnnnnnnntgttttcaatataaatgtttctttaacaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3354079 |
aatatagtatgaatatcttgaaacttgtgtattcgaagtcttaaatatgtaaaaaaatgttttcaatataaatgtttctttaacaa |
3353994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 268
Target Start/End: Complemental strand, 3350135 - 3350088
Alignment:
| Q |
221 |
aatgtaggaagttttggtggcacaatacctgcagccaaatactaaacc |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3350135 |
aatgtaggaagttttgctggcacaatacctgcagccaaatactaaacc |
3350088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 261
Target Start/End: Complemental strand, 9809931 - 9809895
Alignment:
| Q |
225 |
taggaagttttggtggcacaatacctgcagccaaata |
261 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9809931 |
taggaagttttgctggcacaatacctgcagccaaata |
9809895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 263
Target Start/End: Complemental strand, 3342046 - 3342006
Alignment:
| Q |
223 |
tgtaggaagttttggtggcacaatacctgcagccaaatact |
263 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
3342046 |
tgtaggaagctttactggcacaatacctgcagccaaatact |
3342006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 84 - 116
Target Start/End: Original strand, 77381 - 77413
Alignment:
| Q |
84 |
caaatatagtatgaatatcttgaaacttgtgta |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
77381 |
caaatatagtatgagtatcttgaaacttgtgta |
77413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1085 times since January 2019
Visitors: 4112