View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_40 (Length: 346)
Name: NF0641_low_40
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 19 - 346
Target Start/End: Original strand, 53096085 - 53096412
Alignment:
| Q |
19 |
ggacatcatcaccaaaagcattcataagcttacttgctttagaggatcacattttgcaggcatcggaggatccttagagagagatatgtcaagataatgg |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096085 |
ggacatcattaccaaaagcattcataagcttacttgctttagaggatcacattttgcaggcatcggaggatccttagagagagatatgtcaagataatgg |
53096184 |
T |
 |
| Q |
119 |
cactgctgctgaagaataccatttttagtttcaggaaaaatgtccaaactagcagaatgaactgttccaacatcaaaactatttccatttctagtcccat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53096185 |
cactgctgctgaagaataccatttttagtttcaggaaaaatgtccaaactagcagaatgaactgttccaacatcaaaactatttccatttctcgtcccat |
53096284 |
T |
 |
| Q |
219 |
ttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttctttggcaccatgnnnnnn |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096285 |
ttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttctttggcaccatgtttttt |
53096384 |
T |
 |
| Q |
319 |
nggaacttctaaactccggatgagctga |
346 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
53096385 |
tggaacttctaaactccggatgagctga |
53096412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 158 - 307
Target Start/End: Complemental strand, 1369483 - 1369335
Alignment:
| Q |
158 |
atgtccaaactagcagaatgaactgttccaacatcaaaactatttccatttctagtcccatttgagttttgtgctttgattagaactccacactttgatc |
257 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| | | ||| ||||||| |
|
|
| T |
1369483 |
atgtccaaactagtagtatgaactgttccagcatcaaaactatttccatttctcatcccattagagttttgtgctttgattagga-tatacattttgatc |
1369385 |
T |
 |
| Q |
258 |
cttggtgtactctgggttggtgacattcataacgctcgggttctttggca |
307 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
1369384 |
tttggtgaactctggtttggtgacattcataacgctcagattctttggca |
1369335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University