View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_41 (Length: 342)
Name: NF0641_low_41
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_41 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 53096071 - 53096412
Alignment:
| Q |
1 |
gagggaacaaggggggacatcatcaccaaaagcattcataagcttacttgctttagaggatcacattttgcaggcatcggaggatccttagagagagata |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096071 |
gagggaacaaggggggacatcattaccaaaagcattcataagcttacttgctttagaggatcacattttgcaggcatcggaggatccttagagagagata |
53096170 |
T |
|
| Q |
101 |
tgtcaagataatggcactgctgctgaagaataccatttttagtttcaggaaaaatgtccaaactagcagaatgaactgttccaacatcaaaactatttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096171 |
tgtcaagataatggcactgctgctgaagaataccatttttagtttcaggaaaaatgtccaaactagcagaatgaactgttccaacatcaaaactatttcc |
53096270 |
T |
|
| Q |
201 |
atttctagtcccatttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttctttg |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096271 |
atttctcgtcccatttgagttttgtgctttgattagaactccacactttgatccttggtgtactctgggttggtgacattcataacgctcgggttctttg |
53096370 |
T |
|
| Q |
301 |
gcaccatgnnnnnnnggaacttctaaactccggatgagctga |
342 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53096371 |
gcaccatgtttttttggaacttctaaactccggatgagctga |
53096412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 1369483 - 1369335
Alignment:
| Q |
154 |
atgtccaaactagcagaatgaactgttccaacatcaaaactatttccatttctagtcccatttgagttttgtgctttgattagaactccacactttgatc |
253 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| | | ||| ||||||| |
|
|
| T |
1369483 |
atgtccaaactagtagtatgaactgttccagcatcaaaactatttccatttctcatcccattagagttttgtgctttgattagga-tatacattttgatc |
1369385 |
T |
|
| Q |
254 |
cttggtgtactctgggttggtgacattcataacgctcgggttctttggca |
303 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
1369384 |
tttggtgaactctggtttggtgacattcataacgctcagattctttggca |
1369335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 710 times since January 2019
Visitors: 4098