View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_42 (Length: 326)
Name: NF0641_low_42
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 7 - 204
Target Start/End: Complemental strand, 24622836 - 24622639
Alignment:
| Q |
7 |
ctttaagtcaagtcaatagtctgctagaacaatcttgcctcttgtctacgctagtggaacataattaagaatacctcggaataatgattattttcattga |
106 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24622836 |
ctttaagtcaagtcaatagtctacaagaacaatcttgcctcttgtctacgttagtggaacataattaagaatacctcggaataatgattattttcgttga |
24622737 |
T |
 |
| Q |
107 |
tattataaatgacctcgctgaggtaggtttactctagttaattagcctcagttcaagtaatctaaaaatctgatttcatgttttgcatgtcacaggtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24622736 |
tattataaatgacctcgctgaggtaggtttactctagttaattagcctcagttcaagtaatctaaaaatctgatttcttgttttgcatgtcacaggtt |
24622639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 93
Target Start/End: Original strand, 9009326 - 9009408
Alignment:
| Q |
11 |
aagtcaagtcaatagtctgctagaacaatcttgcctcttgtctacgctagtggaacataattaagaatacctcggaataatga |
93 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||| | |||| |||| ||||||||||||||| |||||||| |
|
|
| T |
9009326 |
aagtcaagtcagtagtttgcttgagaaatcttgcctcttgtctatgttagtaaaacaaaattaagaatacctcttaataatga |
9009408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University