View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_54 (Length: 294)
Name: NF0641_low_54
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 31792208 - 31792335
Alignment:
| Q |
8 |
ccaacaatatctagatgtgcggttctcaaaatttaactaagtaaactacggatcccttactgttttatagaatatcgcactcctctcgatttgtcaatcc |
107 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792208 |
ccaacaaagtctagat-tgcggttctcaaaatttaactaagtaaactacggat---------ttttatagaatatcgcactcctctcgatttgtcaatcc |
31792297 |
T |
 |
| Q |
108 |
agacggaggaaaaacaacatttttctcatccgtttgga |
145 |
Q |
| |
|
||| ||| ||||||| |||||||||||| |||||||| |
|
|
| T |
31792298 |
agatagagaaaaaacaccatttttctcatgcgtttgga |
31792335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 232 - 289
Target Start/End: Complemental strand, 37054518 - 37054461
Alignment:
| Q |
232 |
gagaggctaaaacagatttcacctatgaaggctttaccattccaaagggatggaaggt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054518 |
gagaggctaaaacagatttcacctatgaaggctttaccattccaaagggatggaaggt |
37054461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University