View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0641_low_54 (Length: 294)

Name: NF0641_low_54
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0641_low_54
NF0641_low_54
[»] chr3 (1 HSPs)
chr3 (8-145)||(31792208-31792335)
[»] chr8 (1 HSPs)
chr8 (232-289)||(37054461-37054518)


Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 31792208 - 31792335
Alignment:
8 ccaacaatatctagatgtgcggttctcaaaatttaactaagtaaactacggatcccttactgttttatagaatatcgcactcctctcgatttgtcaatcc 107  Q
    |||||||  ||||||| ||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||    
31792208 ccaacaaagtctagat-tgcggttctcaaaatttaactaagtaaactacggat---------ttttatagaatatcgcactcctctcgatttgtcaatcc 31792297  T
108 agacggaggaaaaacaacatttttctcatccgtttgga 145  Q
    |||  ||| ||||||| |||||||||||| ||||||||    
31792298 agatagagaaaaaacaccatttttctcatgcgtttgga 31792335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 232 - 289
Target Start/End: Complemental strand, 37054518 - 37054461
Alignment:
232 gagaggctaaaacagatttcacctatgaaggctttaccattccaaagggatggaaggt 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37054518 gagaggctaaaacagatttcacctatgaaggctttaccattccaaagggatggaaggt 37054461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University