View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0641_low_55 (Length: 284)

Name: NF0641_low_55
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0641_low_55
NF0641_low_55
[»] chr6 (1 HSPs)
chr6 (1-265)||(6048716-6048978)


Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 6048716 - 6048978
Alignment:
1 tattaaaaaagtaattggtataaaagcattaaaaagaataggaaatataaggttgacacttaataccaaagctaaatgatgatttactaattaaannnnn 100  Q
    ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
6048716 tattaaaaaagtaattgatataaaagtattaaaaagaataggaaatataaggttgacacttaataccaaagctaaatgatgatttactaattaa--tttt 6048813  T
101 nnnnnaactttagtgatgatgtgaactttcttatatgggccatgtatttgcaaattaaagttggtaaataactcgtgcttagttgttttgggtgttaacc 200  Q
         ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6048814 tttttaactttagtgatgatgtgaactttcttttatgggccatgtatttgcaaattaaagttggtaaataactcgtgcttagttgttttgggtgttaacc 6048913  T
201 cctcgttccttgagagaaagagaattgttttgcctaggaatcaaactcaggtttttctgaatgat 265  Q
    |||||||||| |||||||||||||||||||||||||  ||||||| |||||||||||||||||||    
6048914 cctcgttcctcgagagaaagagaattgttttgcctaacaatcaaattcaggtttttctgaatgat 6048978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1300 times since January 2019
Visitors: 4114