View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_66 (Length: 242)
Name: NF0641_low_66
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_66 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 29052745 - 29052966
Alignment:
| Q |
21 |
caaaagaagaaattcagctcaatgaacatcaccaacatgctgcaacagaaaacggagagaataatgatgaagtatcaggaatggctaaagcatttcacat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052745 |
caaaagaagaaattcagctcaatgaacatcaccaacatgctgcaacagaaaacggggagaataatgatgaagtatcaggaatggctaaagcatttcacat |
29052844 |
T |
 |
| Q |
121 |
atcatcaagaacagcttctgctataacaatatgtatagtaatggctgcacttgtttttcctttgtttatgacatctttaggacaaggtttggcattgaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052845 |
atcatcaagaacagcttctgctataacaatatgtatagtaatggctgcacttgtttttcctttgtttatgacatctttaggacaaggtttggcattgaag |
29052944 |
T |
 |
| Q |
221 |
acaaagatgttatcatatggaa |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29052945 |
acaaagatgttatcatatggaa |
29052966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University