View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0641_low_70 (Length: 228)

Name: NF0641_low_70
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0641_low_70
NF0641_low_70
[»] chr7 (2 HSPs)
chr7 (1-91)||(42324758-42324848)
chr7 (109-150)||(42324876-42324917)


Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42324758 - 42324848
Alignment:
1 atacctatatttggctttggtatctcatagctcactacttctttccctgtgtgttttacaatttcaatatgtcattatattctctctcatc 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||    
42324758 atacctatatttggctttggtatctcatagctcactacttctttccctgtgtgtgatacaatttcaatatgtcattatattctctctcatc 42324848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 42324876 - 42324917
Alignment:
109 ggcatttttcaaccattaaaatacctaccaaatgtagcatct 150  Q
    ||||||||||||||||||||||||||||||||||||||||||    
42324876 ggcatttttcaaccattaaaatacctaccaaatgtagcatct 42324917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1307 times since January 2019
Visitors: 4114