View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_75 (Length: 208)
Name: NF0641_low_75
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_75 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 16193899 - 16193772
Alignment:
| Q |
1 |
catacatggaaaataaagatagctcaattaagagtagaaggaatcaatgcttctatgtctttggttctctctctaaaatgtacaagaagacaaattatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16193899 |
catacatggaaaataaagatagctcaattaagagtagaaggaatcaatgcttctatgtttttggttctctctctaaaatgtataagaagacaaattatta |
16193800 |
T |
|
| Q |
101 |
gtggtgagaagagatgatgactagtatt |
128 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
16193799 |
gtggtgagaagagatgatgactggtatt |
16193772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1335 times since January 2019
Visitors: 4117