View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_76 (Length: 207)
Name: NF0641_low_76
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 7 - 179
Target Start/End: Complemental strand, 1090813 - 1090637
Alignment:
| Q |
7 |
cgtttgccatctaaaaccgatgtnnnnnnntcgtccaatagtgaactttcttaagcttcgtttcttttttt-aataactcnnnnnnnnn---cttcctga |
102 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
1090813 |
cgtttgctatctaaaaccgatgtaaaaaaatcgtccaatagtgaactttcttaagcttcgtttcttttttttaataactcttttttttttttcttcctga |
1090714 |
T |
 |
| Q |
103 |
tttagtatatcgtaaggttaaactgtatttatcctagtctctaacatttgcattagggctacaaatatctctgctcc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1090713 |
tttagtatatcgtaaggttaaactgtatttatcctagtctctaacatttgcattagggctacaaatatctttgctcc |
1090637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University