View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_78 (Length: 205)
Name: NF0641_low_78
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0641_low_78 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 27508438 - 27508242
Alignment:
Q |
9 |
agcagagagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcgcggtggtagtaaggc |
108 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
27508438 |
agcagggagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcacggtggtagtaaggc |
27508339 |
T |
 |
Q |
109 |
gagaattgattgctgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccggttcaccatcgatctctttgcggt |
205 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
27508338 |
gagaattgattgttgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccgtttcaccatcgatctctttgcggt |
27508242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University