View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0641_low_78 (Length: 205)

Name: NF0641_low_78
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0641_low_78
NF0641_low_78
[»] chr5 (1 HSPs)
chr5 (9-205)||(27508242-27508438)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 27508438 - 27508242
Alignment:
9 agcagagagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcgcggtggtagtaaggc 108  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
27508438 agcagggagagccaacggtctgtgatgtgccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcacggtggtagtaaggc 27508339  T
109 gagaattgattgctgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccggttcaccatcgatctctttgcggt 205  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
27508338 gagaattgattgttgtggtgatggtattgcggcggtggaggtggtggctgtggccggttacatgaactaaccgtttcaccatcgatctctttgcggt 27508242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University