View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0641_low_79 (Length: 203)
Name: NF0641_low_79
Description: NF0641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0641_low_79 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7547325 - 7547235
Alignment:
| Q |
1 |
acggaagcaatttagaaaatggaaaagttgtggtgtgtgtagaagaagagggagcaactccccttctcaacattttttcatattattcgac |
91 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||| |
|
|
| T |
7547325 |
acggaagcaatttagaaaatggaaaaattgaggtgtgtgtagaagaagagggagcaactccccttctctacattttttcattttgttcgac |
7547235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 942 times since January 2019
Visitors: 4105