View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0642_high_14 (Length: 251)
Name: NF0642_high_14
Description: NF0642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0642_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 3542651 - 3542891
Alignment:
| Q |
1 |
tttcttcttaaaaaccaatcaattcattcattatcttccaacacaacacaaacacagaacaaaacatcatcaaaccttgccgttgatggaaaattgtctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542651 |
tttcttcttaaaaaccaatcaattcattcattatcttccaacacaacacaaacacagaacaaaacatcatcaaaccttgccgttgatggaaaattgtctt |
3542750 |
T |
|
| Q |
101 |
acgatcaaacctcacataggattcttcacaagacctannnnnnnnncttcttctttgagttttaggagcagagtacccttgataaaggctagtgctggag |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542751 |
acaatcaaacctcacataggattcttcacaagacctatttctttttcttcttctttgagttttaggagcagagtacccttgataaaggctagtgctggag |
3542850 |
T |
|
| Q |
201 |
ctagtagtcactgtgagtctagtagtttgaacacacctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542851 |
ctagtagtcactgtgagtctagtagtttgaacacacctttg |
3542891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1177 times since January 2019
Visitors: 4113