View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0642_high_4 (Length: 465)
Name: NF0642_high_4
Description: NF0642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0642_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-134; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 198 - 460
Target Start/End: Complemental strand, 42413367 - 42413105
Alignment:
| Q |
198 |
tggaaaacgcaatcggagccattacagcagaggaaaaccctgaaaaccacgagccagaggattttgcagccaccccctcagtctccaatatctcaaacaa |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42413367 |
tggaaaacgcaatcggagccattacagcagaggaaaaccctgaaaaccacgagccagaggattttgcagccaccccctcagtctccaatatctcaaacaa |
42413268 |
T |
 |
| Q |
298 |
catatacctcattgaaacctcatttttcaactctcatttttctagattgctttgataaatttcaacataaaacccatgtcaaattttcaatttttagctc |
397 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42413267 |
catataccttgttgaaacctcatttttcaactctcttttttctggattgctttgataaatttcaacataaaacccatgtcaaattttcaatttttagctc |
42413168 |
T |
 |
| Q |
398 |
tttttggtcttgatcaccgttggggaaatcttgtttctgagaaagttgagtgcctttgcttct |
460 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42413167 |
tttttggtcttgatcaccgttggggaaatcttgtttctgagaaagttgagtgcttttgcttct |
42413105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 42413620 - 42413508
Alignment:
| Q |
1 |
ggttgacaattttaaaagtgatccactagtagacaaattacatacatataactgccatcactcttcaacaatttttcacccttctcgttatcacaagatt |
100 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
42413620 |
ggtttacaactttaaaagtgatccactagtagacaaattacatacatataactgccatcactcttcaacaattgttcatccttctcgttatcacaagatt |
42413521 |
T |
 |
| Q |
101 |
tctctgctacaga |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42413520 |
tctctgctacaga |
42413508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 111 - 200
Target Start/End: Complemental strand, 42413487 - 42413398
Alignment:
| Q |
111 |
agatactctgtttactgtttagcaactggtatttgaattgggaaggaggcgcttgaacaagtaaacggtcaaagtaggacaaactgatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42413487 |
agatactctgtttactgtttagcaactggtatttgaattgggaaggaggcgcttcaacaagtaaacggtcaaagtaggacaaactgatgg |
42413398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University