View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0642_low_18 (Length: 244)
Name: NF0642_low_18
Description: NF0642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0642_low_18 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 244
Target Start/End: Complemental strand, 48013974 - 48013763
Alignment:
Q |
30 |
atccttatccacggtaaattcatctagtataaactcgccattgattagtttaaaatgattaattatattttagcactaaaacaatgattgatatttcaaa |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
48013974 |
atccttatccacggtaaattcatctagtataaactcgccattgattagtttaaaatgattaat---attttagcactaaaacaatgattgatatttcaaa |
48013878 |
T |
 |
Q |
130 |
agtagtaattataaataaattgtgaaatagaactgtatgctattacagcatgcatgtagattttgttagtttgatagagtcggttaaaacttagttggtt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48013877 |
agtagtaattataaataaattgtgaaatagaactgtatgctattacagtatgcatgtagattttgttagtttgatagagtcggttaaaacttagttggtt |
48013778 |
T |
 |
Q |
230 |
tattgctttttatct |
244 |
Q |
|
|
|||||||||||||| |
|
|
T |
48013777 |
aattgctttttatct |
48013763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University