View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0642_low_18 (Length: 244)

Name: NF0642_low_18
Description: NF0642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0642_low_18
NF0642_low_18
[»] chr1 (1 HSPs)
chr1 (30-244)||(48013763-48013974)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 244
Target Start/End: Complemental strand, 48013974 - 48013763
Alignment:
30 atccttatccacggtaaattcatctagtataaactcgccattgattagtttaaaatgattaattatattttagcactaaaacaatgattgatatttcaaa 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||    
48013974 atccttatccacggtaaattcatctagtataaactcgccattgattagtttaaaatgattaat---attttagcactaaaacaatgattgatatttcaaa 48013878  T
130 agtagtaattataaataaattgtgaaatagaactgtatgctattacagcatgcatgtagattttgttagtttgatagagtcggttaaaacttagttggtt 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
48013877 agtagtaattataaataaattgtgaaatagaactgtatgctattacagtatgcatgtagattttgttagtttgatagagtcggttaaaacttagttggtt 48013778  T
230 tattgctttttatct 244  Q
     ||||||||||||||    
48013777 aattgctttttatct 48013763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1182 times since January 2019
Visitors: 4113