View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0642_low_3 (Length: 574)
Name: NF0642_low_3
Description: NF0642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0642_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 512; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 512; E-Value: 0
Query Start/End: Original strand, 30 - 545
Target Start/End: Original strand, 47625327 - 47625842
Alignment:
Q |
30 |
ccatttgctctatgcagagagtgtattggttttgcaacacaaaaaattccatcatcttgtccttcttctaaagaagctgtgatctggtacaacgagtgtt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47625327 |
ccatttgctctatgcagagagtgtattggttttgcaacacaaaaaattccatcatcttgtccttcttctaaagaagctgtgatctggtacaacgagtgtt |
47625426 |
T |
 |
Q |
130 |
tgttaaggtattcctacagattcatcttcatgaaaatggaaacatggcctagatacaagatcgagattccaatgggggaccctgttttgttacagagtaa |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47625427 |
tgttaaggtattcctacagattcatcttcatgaaaatggaaacatggcctagatacaagatcgagattccaatgggggaccctgttttgttacagagtaa |
47625526 |
T |
 |
Q |
230 |
aagattttactctgctttaagatctgttttgaatgttcttccaaaagaagctgcactttctcttggtggttttaacaagtatgctgtgaagcaagaaaat |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47625527 |
aagattttactctgctttaagatctgttttgaatgttcttccaaaagaagctgcactttctcttggtggttttaacaagtatgctgtgaagcaagaaaat |
47625626 |
T |
 |
Q |
330 |
gcttctgccagtgtaacgctatatggtcttgctcagtgcacaccggacttgtcagccggagattgtaggcggtgtattgaggttgcggtggtagaatttc |
429 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47625627 |
gcttctgccagtgtaacgctatatggtcttgctcagtgcacaccggacttgtcagccggagattgtaggcggtgtattgaggttgcggtggtagaatttc |
47625726 |
T |
 |
Q |
430 |
ctaaggattgttgtggtggtagcataggggaaactgttttctttccaagttgttttgttaggtttgaaacttatccgttttatcagcattcagagacctc |
529 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47625727 |
ctaaggattgttgtggtggtagcataggggaaactgttttctttccaagttgttttgttaggtttgaaacttatccgttttatcagcattcagagacctc |
47625826 |
T |
 |
Q |
530 |
agcagcagcagcaaca |
545 |
Q |
|
|
|||||||||| ||||| |
|
|
T |
47625827 |
agcagcagcaacaaca |
47625842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 518 times since January 2019
Visitors: 4087