View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_high_10 (Length: 318)
Name: NF0643_high_10
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0643_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 88 - 314
Target Start/End: Original strand, 45348353 - 45348579
Alignment:
Q |
88 |
acatcatcacacaaacacgaatagtcaaagttccactcttttgtc-ttttttaaggtcaacgnnnnnnnngcagctgcttgaataattacgttcattgac |
186 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
45348353 |
acatcatcacacaaacacgaatagtaaaagttccactcttttgtcgttttttaaggtcaacgttttttt-gcagctgcttgaataattacgttcattgac |
45348451 |
T |
 |
Q |
187 |
tttgtagaaccaatattctgtatctaaaattttaagcaaaagtaagaccattaacaaaacaaattagaacactcttctgctttcaaaatatacggcagac |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45348452 |
tttgtagaaccaatattctgtatctaaaattttaagcaaaactaagaccattaacaaaacaaattagaacactcttctgctttcaaaatatacggcagac |
45348551 |
T |
 |
Q |
287 |
aaaaatgaaccaaattagaagacttttt |
314 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
45348552 |
aaaaatgaaccaaattagaagacttttt |
45348579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University