View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_high_13 (Length: 267)
Name: NF0643_high_13
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0643_high_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 29 - 267
Target Start/End: Complemental strand, 48896427 - 48896192
Alignment:
| Q |
29 |
accttcagcataaatctttctcgaatttgtatgcatggatcaaatgcttcatgaatattctcaagttattcaatgatggaccaatctcacaaactttatt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48896427 |
accttcagcataaatctttctcgaatttgtatgcatggatcaaatgcttcatgaatattctcaagttattcaatgatggaccaatctcacaaaattt--- |
48896331 |
T |
|
| Q |
129 |
tgcaagatccctccatcacattctctcaagattgttttctcgaaatgtcaggtagcaaaattaacaatcattagaattcaaatgaaactctttcagataa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48896330 |
tgcaagatccctccatcacattctctcaagattgttttctcgaaatgtcaggtagcaaaattaacaatcattaaaattcaaatgaaactctttcagataa |
48896231 |
T |
|
| Q |
229 |
attatttattgactctctctttactgttttgacaaagct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48896230 |
attatttattgactctctctttactgttttgacaaagct |
48896192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1115 times since January 2019
Visitors: 4112