View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_high_9 (Length: 327)
Name: NF0643_high_9
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0643_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 32876604 - 32876359
Alignment:
| Q |
11 |
cagagaacgagcggtggtggaatctgaaagcgtgttggaataagtcattggtctggtatttaattgggcttagttgtggtgatgcgaagttaagcttctg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32876604 |
cagagaacgagcggtggtggaatctgaaagcgtgttggaataagtcattggtctagtgtttaattgggcttagttgtggtgatgcgaagttaagcttctg |
32876505 |
T |
|
| Q |
111 |
ttttcaagggttttattttattggaggggttatggtagcattcgataggtgattgaattttgtttctatagccactcatgaggaagtgtgggagtttggg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32876504 |
ttttcaagggttttattttattggaggggttatggtagcattcgataggtgattgaattttgtttctatagccactcatgaggaagtgtgggagtttggg |
32876405 |
T |
|
| Q |
211 |
tttgtttttaggtattgcctttgattttggtagttaggtttcttat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32876404 |
tttgtttttaggtattgcctttgattttggtagttaggtttcttat |
32876359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 301
Target Start/End: Original strand, 32880082 - 32880134
Alignment:
| Q |
249 |
tttcttatatgttaggcatcccattcatattggctattatggaaatctcgtac |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32880082 |
tttcttatatgttaggcatcccattcatattggctattatggaaatctcgtac |
32880134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 15676820 - 15676745
Alignment:
| Q |
18 |
cgagcggtggtggaatctgaaagcgtgttggaataagtcattggtctggtatttaattgggcttagttgtggtgat |
93 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||||||||||||| || | |||||||||||||| | || ||||||| |
|
|
| T |
15676820 |
cgagtggtggtggaatatgaaagaatgttggaataagtcattgttcagatatttaattgggctcatttatggtgat |
15676745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 788 times since January 2019
Visitors: 4099