View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_low_11 (Length: 423)
Name: NF0643_low_11
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0643_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 127 - 313
Target Start/End: Complemental strand, 36562842 - 36562656
Alignment:
| Q |
127 |
aaagtaaggttgaggagcttgagaaggatagggatttggctgtgaagaagtcgattgagtcgatgaaggtgattgatgagttgaaggagaagattgattt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36562842 |
aaagtaaggttgaggagcttgagaaggatagggatttggctgtgaagaagtcgattgagtcggtgaaggtgattgatgagttgaaggagaagattgattt |
36562743 |
T |
|
| Q |
227 |
ggtggtgaaggagaagaatgatgctgagggtgtgaatagtactcaggacgtcaagatttccaatcttggacttgagttgcaacagct |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36562742 |
ggtggtgaaggagaagaatgatgctgagggtgtgaatagtactcaggacgtcaagatttccaatcttggacttgagttgcagcagct |
36562656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 150 - 243
Target Start/End: Original strand, 952083 - 952176
Alignment:
| Q |
150 |
aaggatagggatttggctgtgaagaagtcgattgagtcgatgaaggtgattgatgagttgaaggagaagattgatttggtggtgaaggagaaga |
243 |
Q |
| |
|
||||||| ||||| || |||||| |||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
952083 |
aaggataaggattaggttgtgaataagttgtttgaatcgatgaaggtgattgatgagttgaaggagaagattgttttggtggtgtatgagaaga |
952176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 862 times since January 2019
Visitors: 4101