View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_low_13 (Length: 384)
Name: NF0643_low_13
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0643_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 94 - 374
Target Start/End: Original strand, 49163146 - 49163426
Alignment:
Q |
94 |
catgacatgcaccaagtagaacctcacatgagttggtcttatctctacttgtcttcgaatacttcttagctaaactttgagcttcggctacatatccgcc |
193 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
49163146 |
catggcatgcaccaagtagaacctcacatgagttggtcttatctctacttgtctttgaatacttcctagctaaactttgagcttcggctacatatccgcc |
49163245 |
T |
 |
Q |
194 |
tcgaccaagcatatccaccatgcatgccacatgatccattccttgtacaagtccatattccaaactcattgattgaaagaaagcaaagccttcatcaata |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49163246 |
tcgaccaagcatatccaccatgcatgccacatgatccattccttggacaagtccatattccaaactcattgattgaaagaaagcaaagccttcatcaata |
49163345 |
T |
 |
Q |
294 |
agccccaaatggctgcaagtcattaacagccctgtgaaggttacttcatcaggtcttacaccagatgccaccatttctctg |
374 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49163346 |
agccccaaatggctgcaagtcattagcagccctgtgaaggttacttcatcaggtcttacaccagatgccaccatttctctg |
49163426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University