View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0643_low_18 (Length: 346)

Name: NF0643_low_18
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0643_low_18
NF0643_low_18
[»] chr2 (1 HSPs)
chr2 (101-346)||(37138114-37138347)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 101 - 346
Target Start/End: Original strand, 37138114 - 37138347
Alignment:
101 ctgatgaaggcggtcccaccaatcaagaatttgcttggactcttggatcaaattggaacaacatgcctggcatatgttaatttgagctcaaagacnnnnn 200  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||           
37138114 ctgatgaaagcggtcccaccaatcaagaatttgcttggactcttggatcaaattggaacaacatgccaggcatatgttaatttgagctcaaag------- 37138206  T
201 nnnngttttgttttgtaatgattacaaaacgaatattcctagtgaagtagatggtagaaccatatgatgtaatagttagaatatttaatggtagagatta 300  Q
         || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37138207 -----ttgtgttttgtaatgattacaaaacgaatattcgtagtgaagtagatggtagaaccatatgatgtaatagttagaatatttaatggtagagatta 37138301  T
301 gtaatgctcatatgggttggataatataatgacattaaatttttat 346  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
37138302 gtaatgctcatatgggttggataatataatgacattaaatttttat 37138347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University