View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_low_18 (Length: 346)
Name: NF0643_low_18
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0643_low_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 101 - 346
Target Start/End: Original strand, 37138114 - 37138347
Alignment:
| Q |
101 |
ctgatgaaggcggtcccaccaatcaagaatttgcttggactcttggatcaaattggaacaacatgcctggcatatgttaatttgagctcaaagacnnnnn |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37138114 |
ctgatgaaagcggtcccaccaatcaagaatttgcttggactcttggatcaaattggaacaacatgccaggcatatgttaatttgagctcaaag------- |
37138206 |
T |
 |
| Q |
201 |
nnnngttttgttttgtaatgattacaaaacgaatattcctagtgaagtagatggtagaaccatatgatgtaatagttagaatatttaatggtagagatta |
300 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37138207 |
-----ttgtgttttgtaatgattacaaaacgaatattcgtagtgaagtagatggtagaaccatatgatgtaatagttagaatatttaatggtagagatta |
37138301 |
T |
 |
| Q |
301 |
gtaatgctcatatgggttggataatataatgacattaaatttttat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37138302 |
gtaatgctcatatgggttggataatataatgacattaaatttttat |
37138347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University