View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_low_30 (Length: 301)
Name: NF0643_low_30
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0643_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 100 - 242
Target Start/End: Original strand, 11115481 - 11115623
Alignment:
Q |
100 |
aattattataaatctaatctttgagtttttgcacaatcagtggcaatgggaagaaacatgggacaaccatatggaatcgtccaatgcttgtgaaaggacc |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11115481 |
aattattataaatctaatctttgagtttttgcacaatcagtggcaatgggaagaaacatgggacaaccatatggaatcgtccaatgcttgtgaaaggacc |
11115580 |
T |
 |
Q |
200 |
tcttggaattgtttctattacagaaatatcattcttgcctatg |
242 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
11115581 |
tcttggaattgtttctattacagaaatagcattcttgcttatg |
11115623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 125 - 237
Target Start/End: Original strand, 11103652 - 11103764
Alignment:
Q |
125 |
tttttgcacaatcagtggcaatgggaagaaacatgggacaaccatatggaatcgtccaatgcttgtgaaaggacctcttggaattgtttctattacagaa |
224 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
T |
11103652 |
tttttgcacaatcagtcgcaatgggaagaaacatgggacaaccatatggaaccgtccaatgcttgtaaaaggacctcttggaattgtttctatcacagaa |
11103751 |
T |
 |
Q |
225 |
atatcattcttgc |
237 |
Q |
|
|
||| ||||||||| |
|
|
T |
11103752 |
atagcattcttgc |
11103764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 125 - 237
Target Start/End: Original strand, 11590090 - 11590202
Alignment:
Q |
125 |
tttttgcacaatcagtggcaatgggaagaaacatgggacaaccatatggaatcgtccaatgcttgtgaaaggacctcttggaattgtttctattacagaa |
224 |
Q |
|
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
T |
11590090 |
tttttgtacaatcagtcgcaatgggaagaaacatgggacaaccatatggaaccgtccaatgcttgtaaaaggacctcttggaattgtttctatcacagag |
11590189 |
T |
 |
Q |
225 |
atatcattcttgc |
237 |
Q |
|
|
||| |||| |||| |
|
|
T |
11590190 |
atagcatttttgc |
11590202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1116 times since January 2019
Visitors: 4112