View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_low_36 (Length: 219)
Name: NF0643_low_36
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0643_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 42086016 - 42085886
Alignment:
| Q |
1 |
gttttctgtgttgggtgggagattatggtcggaagagatgaaagggattgtgaggagattgatggaggaatttggtgggagagaggttttgagtttttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086016 |
gttttctgtgttgggtgggagattatggtcggaagagatgaaagggattgtgaggagattgatggaggaatttggtgggagagaggttttgagtttttgg |
42085917 |
T |
|
| Q |
101 |
atgttgtgtggtgtgttgattatgatgatgt |
131 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
42085916 |
atgttgtgtggtgtgttgattatggtgatgt |
42085886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 42081793 - 42081670
Alignment:
| Q |
1 |
gttttctgtgttgggtgggagattatggtcggaagagatgaaagggattgtgaggagattgatggaggaatttggtgggagagaggttttgagtttttgg |
100 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||| ||||||| |||| || ||||||||||| | || ||||||||| |
|
|
| T |
42081793 |
gttttctgtgttgagtgggaggttatggtcggaagaaatgaaagggattgtgaggaaattgatgtaggagttaggtgggagagaaggttgaagtttttgg |
42081694 |
T |
|
| Q |
101 |
atgttgtgtggtgtgttgattatg |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42081693 |
atgttgtgtggtgtgttgattatg |
42081670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 980 times since January 2019
Visitors: 4105