View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0643_low_38 (Length: 210)
Name: NF0643_low_38
Description: NF0643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0643_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 8e-57; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 31063604 - 31063723
Alignment:
| Q |
1 |
cctgatctgagaatttctcgctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31063604 |
cctgatctgagaatttcttgctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaa |
31063703 |
T |
|
| Q |
101 |
ttcttctaaggatgatgatg |
120 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
31063704 |
ttcttctaaggatgctgatg |
31063723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 14 - 119
Target Start/End: Original strand, 31074997 - 31075102
Alignment:
| Q |
14 |
tttctcgctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaattcttctaaggat |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||| |||||||||| |||||||||||| || |
|
|
| T |
31074997 |
tttcttgctcatgcattctaagtctcttagcttctactaatgctgcaacaatcataactatgactgaagatgtgaagccaatggaaattcttctaagtat |
31075096 |
T |
|
| Q |
114 |
gatgat |
119 |
Q |
| |
|
| |||| |
|
|
| T |
31075097 |
gctgat |
31075102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 58
Target Start/End: Original strand, 31057542 - 31057579
Alignment:
| Q |
21 |
ctcatgcattctaagtctcttagcttctactaaggctg |
58 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
31057542 |
ctcaagcattctaagtctcttaacttctactaaggctg |
31057579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1192 times since January 2019
Visitors: 4113