View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0644_high_2 (Length: 204)
Name: NF0644_high_2
Description: NF0644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0644_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 50 - 190
Target Start/End: Complemental strand, 23365856 - 23365714
Alignment:
| Q |
50 |
ccgattcattctttcaaaatcaattccatgagaagtttcaaatcctagctttcatagcgagtgtcaaataaattcttccttaa--tttttggttggaagt |
147 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||| |||||||||| ||| |
|
|
| T |
23365856 |
ccgattcattcttttagaatcaattccatgagaagtttcaaatcctagctttcatatagagcgtcaaatcaattcttccttaaatattttggttggtagt |
23365757 |
T |
|
| Q |
148 |
tagatgactcattttctctattcttttccctcaccttcatctc |
190 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| |||||| |
|
|
| T |
23365756 |
tagataactcattttctctattcttttctttcacctccatctc |
23365714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3129 times since January 2019
Visitors: 4028