View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0644_low_4 (Length: 319)
Name: NF0644_low_4
Description: NF0644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0644_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 54 - 247
Target Start/End: Original strand, 42239034 - 42239227
Alignment:
| Q |
54 |
caccttgttcttctgcctctttgttatgtggaatcaagtagtacaattttccacccttcaattcatgatcttgtgatagagtttctgttgcattcttcga |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42239034 |
caccttgttcttctgcctctttgttatgtggaatcaagtagtacaattttccacccttcaattcatgatcttgtgatagagtttctgttgcattcttcga |
42239133 |
T |
 |
| Q |
154 |
atcaacaatagcagcattagtaggaaaatttatcaaaatgtctttcacatggattggtgaactaaactctagcatcttaccatattcttcgaca |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||| |
|
|
| T |
42239134 |
atcaacaatagcagcattagtaggaaaatttatcaaaatgtctttcacatggattggtgaactaaactctagtatcttaccatcttctttgaca |
42239227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University