View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0644_low_7 (Length: 289)
Name: NF0644_low_7
Description: NF0644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0644_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 37 - 240
Target Start/End: Original strand, 1571986 - 1572187
Alignment:
| Q |
37 |
tttgaaggagaatgatgagaaattggagaaagaaataatgtgttggagaaagtagtagaggctgccattgaattgatattgatgctgatgcttgtaatct |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1571986 |
tttgaaggagaatgatgagaaattggagaaagaaataatgtgttggagaaagtagtagaggctgccattgaattgatattgatgctgatgcttgtaatct |
1572085 |
T |
 |
| Q |
137 |
ttcctcttctaattatacttaacactattaacaatgagttttaagtgttgcaacataaacgatgtggtaacaaccaacaacatctaccagtttcacactt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1572086 |
ttcctcttctaattatacttaacactgttaacaatgag--ttaagtgttgcaacataaacgatgcggtaacaaccaacaacatctaccagtttcacactt |
1572183 |
T |
 |
| Q |
237 |
tcat |
240 |
Q |
| |
|
|||| |
|
|
| T |
1572184 |
tcat |
1572187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University