View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_22 (Length: 362)
Name: NF0645_high_22
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_high_22 |
 | |
|
| [»] scaffold0693 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0693 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 28 - 234
Target Start/End: Original strand, 3623 - 3829
Alignment:
| Q |
28 |
catttgaagcctgtctttttgcactaactggatcagaagcattccagtggatgaaagtatgcaacaaattcaccagattctgctaccaaattggaggggc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3623 |
catttgaagcctgtctttttgcactaactggatcagaagcattccagtggatgaaagtatgcaacaaattcaccagattctgctaccaaattggaggggc |
3722 |
T |
|
| Q |
128 |
aatattatgctgctatatagcatccattttaatggctatgatatcaactatctcagcttacaaagtattaagaatgtactctccaaagaggttcctgcgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3723 |
aatattatgctgctatatagcatccattttaatggctatgatatcaactatctcagcttacaaagtattaagaatgtactctccaaagaggttcctgcgt |
3822 |
T |
|
| Q |
228 |
ttgaagg |
234 |
Q |
| |
|
||||||| |
|
|
| T |
3823 |
ttgaagg |
3829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 273 - 360
Target Start/End: Original strand, 3931 - 4018
Alignment:
| Q |
273 |
cgtgtgcaagcaagagggataggtacacatagctggttgcatttattgtcggttcctaatattgtttgaatttgtctctgctcctcct |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3931 |
cgtgtgcaagcaagagggataggtacacatagctagttgcatttattgtcggttcctaatattgtttgaatttgtctcttctcctcct |
4018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3652 times since January 2019
Visitors: 4039