View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0645_high_24 (Length: 351)

Name: NF0645_high_24
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0645_high_24
NF0645_high_24
[»] chr1 (1 HSPs)
chr1 (8-74)||(50016648-50016714)
[»] chr7 (2 HSPs)
chr7 (141-179)||(6384195-6384233)
chr7 (197-231)||(29286478-29286512)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 50016714 - 50016648
Alignment:
8 ctcacttatgtctctgttttccttcctctcctccttctccatcttttgttcaccctcttgctttcct 74  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50016714 ctcacttatgtctctgttttccttcctctcctccttctccatcttttgttcaccctcttgctttcct 50016648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 179
Target Start/End: Complemental strand, 6384233 - 6384195
Alignment:
141 tttatgataatggatgcaataaaccgaaaaataaaaatc 179  Q
    |||||||||||||||||||||||| ||||||||||||||    
6384233 tttatgataatggatgcaataaacagaaaaataaaaatc 6384195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 29286512 - 29286478
Alignment:
197 tggagaatgaaaagaagaaggaagaaacctgaatt 231  Q
    ||||||||||||||| |||||||||||||||||||    
29286512 tggagaatgaaaagacgaaggaagaaacctgaatt 29286478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University