View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_25 (Length: 350)
Name: NF0645_high_25
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 50016714 - 50016648
Alignment:
| Q |
8 |
ctcacttatgtctctgttttccttcctctcctccttctccatcttttgttcaccctcttgctttcct |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50016714 |
ctcacttatgtctctgttttccttcctctcctccttctccatcttttgttcaccctcttgctttcct |
50016648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 6384233 - 6384195
Alignment:
| Q |
140 |
tttatgataatggatgcaataaaccgaaaaataaaaatc |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6384233 |
tttatgataatggatgcaataaacagaaaaataaaaatc |
6384195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 230
Target Start/End: Complemental strand, 29286512 - 29286478
Alignment:
| Q |
196 |
tggagaatgaaaagaagaaggaagaaacctgaatt |
230 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29286512 |
tggagaatgaaaagacgaaggaagaaacctgaatt |
29286478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University