View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_33 (Length: 260)
Name: NF0645_high_33
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_high_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 22 - 260
Target Start/End: Original strand, 38525579 - 38525816
Alignment:
| Q |
22 |
cttcttacatattaaaaaagtttcctcgacaaattagatagtgaatctagtatttggaaggttggtgatggtaaacatgcatatatcctttttagagtga |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38525579 |
cttcttacatattaaaaaagtttcatcgacaa-ttagatagtgaatctagtatttggaaggttggtgatggtaaacatgcatatatcctttttagagtga |
38525677 |
T |
|
| Q |
122 |
taagtagatatcatcttgcattagtgatgttatttatgataaaattatgtttgtaatctccaaactgtcatgttaggggatttcatagtaagtggtgaat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38525678 |
taagtagatatcatcttgcattagtgatgttatttatgataaaattatgtttgtaatctccaaactgtcatgttaggggatttcatagtaagtggtgaat |
38525777 |
T |
|
| Q |
222 |
ggattgttcaacaaaaaactctgtttacatttcttctaa |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38525778 |
ggattgttcaacaaaaaactctgtttacatttcttctaa |
38525816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3291 times since January 2019
Visitors: 4031