View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_38 (Length: 240)
Name: NF0645_high_38
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0645_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 31849979 - 31849800
Alignment:
Q |
1 |
cacatgaccttcatctcgtatgtttccatttttggcaaatgacgtgaagtccattgaatcaattaacttctgatgacatgtaatatgatagtgtatgtga |
100 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
31849979 |
cacatgaccttcatc--gtatgtttccatttttggcaaatgacgtgaaatccattgaatcaattaacttctgatgacatgtgatatgatagtgtatgtga |
31849882 |
T |
 |
Q |
101 |
ttgtaatctcatttggatgtcttgcaactagaatccataaatgcttctttccatgtcccttacatagaaagtctaagtataa |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31849881 |
ttgtaatctcatttggatgtcttgcaactagaatccataaatgcttctttccatgtcccttacatagaaagtctaagtataa |
31849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 227
Target Start/End: Complemental strand, 31849747 - 31849709
Alignment:
Q |
189 |
agaacggaaatagaaacatcgatataatgaaatgctccc |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
31849747 |
agaacggaaatagaaacatcgatataatgaaatactccc |
31849709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3621 times since January 2019
Visitors: 4039