View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_40 (Length: 228)
Name: NF0645_high_40
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0645_high_40 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 31850845 - 31850625
Alignment:
Q |
7 |
gcttgtttattatacgtctttatttcaactatgcatggcatctccgtttcttccatttcttcctcatttccatcttcctcaacatccccttcaccattct |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
31850845 |
gcttgtttattatacgtctttatttcaactatgcatggcatctccgtttcttccatttcttcctcatttccatcttcctcaacatccccttcaacattct |
31850746 |
T |
 |
Q |
107 |
ctccattttcctcatctttacttgtaagacgatcnnnnnnngtcaataatggtatgagtattggtttgaatgtgcatgctttatgatgcacaagctacct |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||| |||||||||||||||||||||||||| || |
|
|
T |
31850745 |
ctccattttcctcatctttacttgtaagacgatc-ttttttgtcaagaatggtatgagtattgctttgaacgtgcatgctttatgatgcacaagctagct |
31850647 |
T |
 |
Q |
207 |
agttgtaaactcatacgtccta |
228 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
31850646 |
agttgtaaactcatacgtccta |
31850625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3619 times since January 2019
Visitors: 4039