View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0645_high_43 (Length: 204)

Name: NF0645_high_43
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0645_high_43
NF0645_high_43
[»] chr2 (2 HSPs)
chr2 (1-124)||(3807771-3807894)
chr2 (38-124)||(3776065-3776151)


Alignment Details
Target: chr2 (Bit Score: 124; Significance: 5e-64; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 3807894 - 3807771
Alignment:
1 gattttgattaacttgctcattctccctacttctccaacaaacacttcaggtaccttcttaaccaagttgttgtattcatcacttccttttgccatctca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3807894 gattttgattaacttgctcattctccctacttctccaacaaacacttcaggtaccttcttaaccaagttgttgtattcatcacttccttttgccatctca 3807795  T
101 aactcagcttggaagttcatctca 124  Q
    ||||||||||||||||||||||||    
3807794 aactcagcttggaagttcatctca 3807771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 124
Target Start/End: Complemental strand, 3776151 - 3776065
Alignment:
38 acaaacacttcaggtaccttcttaaccaagttgttgtattcatcacttccttttgccatctcaaactcagcttggaagttcatctca 124  Q
    |||||||||||||| | |||||  || |  ||||||||||||||||||||  ||||||||||||||||||||||||| |||| ||||    
3776151 acaaacacttcaggcagcttctggacaagtttgttgtattcatcacttccccttgccatctcaaactcagcttggaaattcagctca 3776065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3629 times since January 2019
Visitors: 4039