View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_43 (Length: 204)
Name: NF0645_high_43
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 5e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 3807894 - 3807771
Alignment:
| Q |
1 |
gattttgattaacttgctcattctccctacttctccaacaaacacttcaggtaccttcttaaccaagttgttgtattcatcacttccttttgccatctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807894 |
gattttgattaacttgctcattctccctacttctccaacaaacacttcaggtaccttcttaaccaagttgttgtattcatcacttccttttgccatctca |
3807795 |
T |
 |
| Q |
101 |
aactcagcttggaagttcatctca |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3807794 |
aactcagcttggaagttcatctca |
3807771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 124
Target Start/End: Complemental strand, 3776151 - 3776065
Alignment:
| Q |
38 |
acaaacacttcaggtaccttcttaaccaagttgttgtattcatcacttccttttgccatctcaaactcagcttggaagttcatctca |
124 |
Q |
| |
|
|||||||||||||| | ||||| || | |||||||||||||||||||| ||||||||||||||||||||||||| |||| |||| |
|
|
| T |
3776151 |
acaaacacttcaggcagcttctggacaagtttgttgtattcatcacttccccttgccatctcaaactcagcttggaaattcagctca |
3776065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University