View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_high_9 (Length: 437)
Name: NF0645_high_9
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_high_9 |
 |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 29 - 386
Target Start/End: Complemental strand, 45269163 - 45268809
Alignment:
| Q |
29 |
atgaatgactgagtagtgagtactgtctgtaatgaagtttagattgacaataaaagcaaagaggaatactaaactatggcttttcacattccatgttagg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45269163 |
atgaatgactgagtagtgagtactgtctataatgaagtttagattgacaataaaagcaaagaggaatactaaactatggcttttcacattccatattagg |
45269064 |
T |
 |
| Q |
129 |
gaaactgagtgaggagtgtgacgtactcttttttattttgtggtggcatttgaaatttgagattgattcgtaaactcttgagtagcctgtactagcctag |
228 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
45269063 |
gaaactgagtgaggagtgtgac--actcttttttattttgtggtggcatttgaaatttgagattgattcgtaaactcttgtgtagcctgtactaccctag |
45268966 |
T |
 |
| Q |
229 |
ctactcttttctgcaaaccaaagctcagggcttcttggaagttggaacaagtaatcgacagtcacattaaaagtgattaaatgatttctaatgaattgca |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45268965 |
ctactcttttctgcaaaccaaagctcagggcttcttggaagttggaacaagtaatcgaaagtcacattaaaagtgattaaatgatttccaatgaattgca |
45268866 |
T |
 |
| Q |
329 |
tattatatgtagggaccggggttcgaacctcgtacacttcatatttaaattgtgtgag |
386 |
Q |
| |
|
||||||||| || |||| ||||||||||||| | |||| |||||||||||| |||||| |
|
|
| T |
45268865 |
tattatatgcagagacc-gggttcgaacctcatgcactccatatttaaattatgtgag |
45268809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 365
Target Start/End: Complemental strand, 5641655 - 5641613
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacac |
365 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
5641655 |
attgcatattatatgcaggggccggggttcgaacctcggacac |
5641613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 48546202 - 48546236
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48546202 |
attgcatattatatgtagggatcggggttcgaacc |
48546236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 53163623 - 53163657
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
53163623 |
attgcatattatatgtaggggccggggttcgaacc |
53163657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 355
Target Start/End: Original strand, 8125668 - 8125700
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaa |
355 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
8125668 |
attgcatattatatgcagggaccggggttcgaa |
8125700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 359
Target Start/End: Complemental strand, 29373490 - 29373454
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctc |
359 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
29373490 |
attgcatattatatgcaggggccggggttcgaacctc |
29373454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Original strand, 429 - 472
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacact |
366 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
429 |
attgcatattatatgcaggggccggggttcgaacctcggacact |
472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Original strand, 14204301 - 14204344
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacact |
366 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
14204301 |
attgcatattatatgtaggggctggggttcgaacctcggacact |
14204344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 386
Target Start/End: Original strand, 21388552 - 21388615
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacacttcatatttaaattgtgtgag |
386 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| || ||||| || | |||||||||||||| |
|
|
| T |
21388552 |
attgcatattatatgcaggagccggggttcgaaccccggacactccacaattaaattgtgtgag |
21388615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 386
Target Start/End: Complemental strand, 47255123 - 47255060
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacacttcatatttaaattgtgtgag |
386 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||| || |||||||| | |||||||||||||| |
|
|
| T |
47255123 |
attgcatattatctgcaggagccggggttcgaaccccggacacttcacaattaaattgtgtgag |
47255060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 21066915 - 21066949
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
21066915 |
attgcatattatatgtaggggccggggttcgaacc |
21066949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 360
Target Start/End: Original strand, 27424868 - 27424905
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcg |
360 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
27424868 |
attgcatattatatgcaggggccggggttcgaacctcg |
27424905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 355
Target Start/End: Complemental strand, 15074943 - 15074911
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaa |
355 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
15074943 |
attgcatattatatgcagggaccggggttcgaa |
15074911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 365
Target Start/End: Complemental strand, 25711194 - 25711158
Alignment:
| Q |
329 |
tattatatgtagggaccggggttcgaacctcgtacac |
365 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25711194 |
tattatatgtaggggccggggttcgaacctcggacac |
25711158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 386
Target Start/End: Complemental strand, 39919134 - 39919071
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacacttcatatttaaattgtgtgag |
386 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| || ||||| || | |||||||||||||| |
|
|
| T |
39919134 |
attgcatattatatgcaggagccggggttcgaaccccggacactccacaattaaattgtgtgag |
39919071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 12891586 - 12891620
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
12891586 |
attgcatattatatgtaggggccggggttcgaacc |
12891620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 26912862 - 26912896
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
26912862 |
attgcatattatatgtaggggccggggttcgaacc |
26912896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Original strand, 15208551 - 15208594
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacact |
366 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
15208551 |
attgcatattatatataggaaccggggttcgaacctcggacact |
15208594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Original strand, 19963811 - 19963857
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacacttca |
369 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
19963811 |
attgcatattatatgcaggggtcggggttcgaacctcggacacttca |
19963857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 33530822 - 33530856
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33530822 |
attgcatattatatgtagggatcggggttcgaacc |
33530856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 356
Target Start/End: Original strand, 42395256 - 42395289
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaac |
356 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
42395256 |
attgcatattatatgtaggggccggggttcgaac |
42395289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 386
Target Start/End: Complemental strand, 38179286 - 38179223
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacacttcatatttaaattgtgtgag |
386 |
Q |
| |
|
||||||| ||||||| |||| | ||||||||||||||| ||||| || | |||||||||||||| |
|
|
| T |
38179286 |
attgcattttatatgcaggggctggggttcgaacctcggacactccacaattaaattgtgtgag |
38179223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 365
Target Start/End: Original strand, 1844846 - 1844888
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacac |
365 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
1844846 |
attgcatattatatgcaggggccggggttcgaacctcggacac |
1844888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Complemental strand, 20528213 - 20528163
Alignment:
| Q |
326 |
gcatattatatgtagggaccggggttcgaacctcgtacacttcatatttaa |
376 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
20528213 |
gcatgttatatgtagggactggggttcgaacctcagacacttcacatttaa |
20528163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 44948625 - 44948659
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44948625 |
attgcatattatatgcagggaccggggttcgaacc |
44948659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 325 - 357
Target Start/End: Original strand, 32084873 - 32084905
Alignment:
| Q |
325 |
tgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
32084873 |
tgcatattatatgtaggggccggggttcgaacc |
32084905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 365
Target Start/End: Original strand, 32288408 - 32288444
Alignment:
| Q |
329 |
tattatatgtagggaccggggttcgaacctcgtacac |
365 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32288408 |
tattatatgtagggatcggggttcgaacctcggacac |
32288444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Original strand, 14349673 - 14349716
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacact |
366 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
14349673 |
attgcatattatatgtagggatcggggttcgaaccccggacact |
14349716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 33033155 - 33033189
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33033155 |
attgcatattatatgcagggaccggggttcgaacc |
33033189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 357
Target Start/End: Original strand, 42054362 - 42054396
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
42054362 |
attgcatattatatgtaggggccggggttcgaacc |
42054396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 325 - 366
Target Start/End: Complemental strand, 35195678 - 35195637
Alignment:
| Q |
325 |
tgcatattatatgtagggaccggggttcgaacctcgtacact |
366 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
35195678 |
tgcatattatatgcagggaccagggttcgaaccccgtacact |
35195637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 357
Target Start/End: Complemental strand, 24168642 - 24168614
Alignment:
| Q |
329 |
tattatatgtagggaccggggttcgaacc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24168642 |
tattatatgtagggaccggggttcgaacc |
24168614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Complemental strand, 13773433 - 13773387
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcgtacacttca |
369 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
13773433 |
attgcatattatatgtaggagccggggttcgaaccccggacacttca |
13773387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 360
Target Start/End: Original strand, 43656065 - 43656102
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaacctcg |
360 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43656065 |
attgcatattatatgtaggggtcggggttcgaacctcg |
43656102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 366
Target Start/End: Complemental strand, 14876644 - 14876600
Alignment:
| Q |
322 |
aattgcatattatatgtagggaccggggttcgaacctcgtacact |
366 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
14876644 |
aattgcatattatatgcaggagccggggttcgaacctcggacact |
14876600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 356
Target Start/End: Complemental strand, 14709061 - 14709028
Alignment:
| Q |
323 |
attgcatattatatgtagggaccggggttcgaac |
356 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
14709061 |
attgcatattatatgtaggggccggggttcgaac |
14709028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University